Operon: No data
| SCO7682 |
SCO7682 |
SC4C2.17 |
+ |
8506283..8512972 |
putative non-ribosomal peptide synthase |
Promoters
| AbsC |
- |
Negative |
-103:-64(from translation start site) |
8506180..8506219 |
GTGATTACGATGTGAACTATAGAAATGATAATCATTTCTA |
Hesketh A, et al. (2009): AR, DB, FT, GS, OV, qRT-PCR
|
| Zur |
- |
Negative |
-89:-68(from translation start site) |
8506194..8506215 |
AACTATAGAAATGATAATCATT |
Hesketh A, et al. (2009): AR, DB, FT, GS, OV, qRT-PCR
Kallifidas D, et al. (2010): AR, DB, GS, qPCR
|
| Comments:
|
| AbsC |
An AbsC binding site was identified in a divergent promoter region within the coelibactin biosynthetic gene cluster, adjacent to a putative Zur binding site. Repression of the coelibactin gene cluster by both AbsC and Zur appears to be required to maintain appropriate intracellular levels of zinc in S. coelicolor. |
| Zur |
The Zinc-Responsive Regulator Zur Controls Expression of the Coelibactin Gene Cluster in Streptomyces coelicolor. |
Terminator
No Data
Overview

|
|