| | 
 Operon: No data 
  
  
  
  
  
  
 
  | SCO7682 | SCO7682 | SC4C2.17 | + | 8506283..8512972 | putative non-ribosomal peptide synthase |  
 
 Promoters
  
  
  
  
  
  
    
 
  | AbsC | - | Negative | -103:-64(from translation start site) | 8506180..8506219 | GTGATTACGATGTGAACTATAGAAATGATAATCATTTCTA | Hesketh A, et al. (2009): AR, DB, FT, GS, OV, qRT-PCR 
 |  
  | Zur | - | Negative | -89:-68(from translation start site) | 8506194..8506215 | AACTATAGAAATGATAATCATT | Hesketh A, et al. (2009): AR, DB, FT, GS, OV, qRT-PCR Kallifidas D, et al. (2010): AR, DB, GS, qPCR
 
 |  
 
  
  | Comments: |  
  | AbsC | An AbsC binding site was identified in a divergent promoter region within the coelibactin biosynthetic gene cluster, adjacent to a putative Zur binding site.  Repression of the coelibactin gene cluster by both AbsC and Zur appears to be required to maintain appropriate intracellular levels of zinc in S. coelicolor. |  
  | Zur | The Zinc-Responsive Regulator Zur Controls Expression of the Coelibactin Gene Cluster in Streptomyces coelicolor. |  
 
 TerminatorNo Data
 
 Overview
  
 
 
 | 
 |