DBSCR - Transcription factor

   Database of transcriptional regulation in Streptomyces coelicolor
Home
 Transcription factors
 Regulated genes
 Revised TLS
 Search
 Contacts

Transcription factor: DmdR1

Gene ID SCO4394 (link to ScoCyc)
Factor type ND
Pfam PF02742 (Iron dependent repressor, metal binding and dimerisation domain ) PF01325 (Iron dependent repressor, N-terminal DNA binding domain ) PF04023 (FeoA domain )
Consensus seq. ND
Comment None

Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
desA None Negative 3035554..3035582 -25:+4 TTAACTTAGGTTAGGCTCACCTAAGTCGT Tunca S, et al. (2007): DB, GS



DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita