Transcription factor: SCO3201
| Gene ID |
SCO3201 (link to ScoCyc) |
| Factor type |
TetR-family |
| Pfam |
None |
| Consensus seq. |
ND |
| Comment |
SCO3201 was shown to negatively regulate its own transcription, and its DNA binding motif was found to overlap its -35 promoter sequence. The direct and functional
interaction of SCO3201 with the promoter region of scbA, a gene under the positive control of the TetR-like
regulator, ScbR, was indeed demonstrated by in vitro as well as in vivo approaches. |
| SCO3201 |
None |
Negative |
3509954..3510010 |
-56:+1 |
ACCCCGGGGTGGCCCGCCGAATGGCAGATTCTGCCACAGCGGCATAGCCTGCCGAAG |
Xu D, et al. (2010): OV, DB, GS, FT, RACE, RT-PCR
|
| scbA |
None |
Positive |
6891207..6891263 |
-39:+18 |
AGGATAGAAAAAAAACCGCTCAGTCTGTATCTTAACGTTCGCGCATACAGAACAGCT |
Xu D, et al. (2010): OV, HM, GS, RT-PCR
|
|