DBSCR - Transcription factor

   Database of transcriptional regulation in Streptomyces coelicolor

Home
Transcription factors
Regulated genes
Revised TLS
Search
Contacts

Transcription factor: SoxR

Gene ID SCO1697 (link to ScoCyc)
Factor type MerR-family
Pfam None
Consensus seq. ND
Comment Using the E. coli SoxR binding sequence, we predicted ?ve candidate genes of the SoxR regulon and demonstrated that SoxR binds to their promoter regions and activates their expression concurrently with the production of the blue antibiotic actinorhodin (a benzoisochromanequinone).

Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
SCO2478 None Positive 2670164..2670194 -83:-53(from translation start site) TTGACCTCAAGCAAACTTGAGGTACCAGGCT Dela Cruz R, et al. (2010): DB, GS, HM, PE, qRT-PCR
Shin JH, et al. (2011): HM, OV, S1, GS
SCO4266 None Positive 4682907..4682937 -71:-41(from translation start site) TTGACCTCAAGCAGGCTTGAGGTCGTTGAGT Dela Cruz R, et al. (2010): DB, GS, HM, PE, qRT-PCR
Shin JH, et al. (2011): HM, OV, S1, GS
SCO7008 None Positive 7782617..7782647 -44:-14(from translation start site) TTGACCTCAAGGTTGGTCGAGGTTCTACGGT Dela Cruz R, et al. (2010): DB, GS, HM, PE, qRT-PCR
Shin JH, et al. (2011): HM, OV, S1, GS
SCO1909 None Positive 2047000..2047030 -71:-41(from translation start site) TTGACCTCAACCTTGGTCGAGGTCGGAGGGT Dela Cruz R, et al. (2010): DB, GS, HM, PE, qRT-PCR
Shin JH, et al. (2011): HM, OV, S1, GS
SCO1178 None Positive 1242790..1242820 -71:-41(from translation start site) TTGACCTCAACCGTGGTCGAGGTACCACGGT Dela Cruz R, et al. (2010): DB, GS, HM, PE, qRT-PCR
Shin JH, et al. (2011): HM, OV, S1, GS




DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita