Operon: No data
hrdD |
SCO3202 |
SCE22.19c, hrdD, sig46 |
- |
3510381..3511379 |
RNA polymerase principal sigma factor |
Promoters
SigE |
hrdD-p1 |
Promoter |
-50:+10 |
3511740..3511799 |
GTGACTCCGCGTCCGTGGCAACCCTCAGGCGGTACGGGCCGTCTTCAGGGTGGGAGAGCA |
Buttner MJ, et al. (1990): S1
Kang JG, et al. (1997): GS, RO
Paget MS, et al. (1999): S1, DB
|
SigR |
hrdD-p2 |
Promoter |
-50:+10 |
3511488..3511547 |
AATCGAGGGGCAGGTTGGGAATTCTGTCCGGATTCCAGTCGTTGTTTCCATCGGATGCAG |
Buttner MJ, et al. (1990): S1
Kang JG, et al. (1997): GS, RO
|
SigE |
hrdD-p2 |
Promoter |
-50:+10 |
3511488..3511547 |
AATCGAGGGGCAGGTTGGGAATTCTGTCCGGATTCCAGTCGTTGTTTCCATCGGATGCAG |
Paget MS, et al. (1999): S1, DB
|
CseB |
hrdD-p1 |
Positive |
ND |
ND |
ND |
Paget MS, et al. (1999): DB
|
CseB |
hrdD-p2 |
Positive |
ND |
ND |
ND |
Paget MS, et al. (1999): DB
|
SigB |
hrdD-p3 |
Promoter |
ND |
ND |
ND |
Lee EJ, et al. (2005): AR, DB
|
Comments:
|
SigE |
hrd-p1 is recognized by sigE in vitro and is highly sigE dependent in vivo. |
SigE |
hrdD-p2 is not recognized by sigE in vitro but is partially sigE dependent in vivo. |
CseB |
Transcript of hrdD-p1 showed ~20-fold low level in CseB mutant. hrdD transcription is partially cseB dependent. |
CseB |
Transcript of hrdD-p2 showed ~20-fold low level in CseB mutant. hrdD transcription is partially cseB dependent. |
Terminator
No Data
Overview

|
|