Operon: No data
Promoters
| CcaR |
- |
Positive |
-840:-815 |
GGAAAAACGTACCCCGGGGTCGGTTT |
Santamarta I, et al. (2002): RG, GS
Santamarta I, et al. (2005): HM, DP, GS
|
S. clavuligerus |
| Brp |
- |
Negative |
-840:-815 |
GGAAAAACGTACCCCGGGGTCGGTTT |
Santamarta I, et al. (2005): HM, DP, GS
|
S. clavuligerus |
| AreB |
- |
Negative |
-840:-815 |
GGAAAAACGTACCCCGGGGTCGGTTT |
Santamarta I, et al. (2005): HM, DP, GS
Santamarta I, et al. (2007): DB, GS, FT, HM, RT-PCR
|
S. clavuligerus |
| Comments:
|
| CcaR |
CcaR protein is an activator controlling the expression of its own ccaR gene; The S. clavuligerus ARE sequence is located in the cmcH?ccaR intergenic region, 890 nt upstream of the ATG start codon of ccaR. This sequence is located upstream (not included) of the DNA fragment previously used as probe to test the autoregulation of ccaR by the CcaR protein. |
| Brp |
A brp gene, encoding a butyrolactone receptor protein, was cloned from S. clavuligerus. Sixty-one nucleotides upstream of brp another ARE sequence (ARE(brp)) was found, suggesting that Brp autoregulates its expression. Pure recombinant rBrp protein binds specifically to the ARE sequences present upstream of ccaR and brp. |
| AreB |
There are at least two (AreB and Brp) and possibly more regulatory proteins interacting with the upstream region of the specific regulatory gene ccaR (Santamarta et al., 2005). Only a very small increase on ccaR expression is observed in the Delta-areB mutant. A small molecule is required to restore rAreB binding ability. |
Terminator
No Data
|
|