Operon: No data
Promoters
| Unknown_sigma |
- |
Promoter |
-50:+10 |
CCGCGTACCTCTGGCATTTCCCCCAGTCTTTCCTGACCAGGATTACCGGCATGTTCGAGA |
Santos-Aberturas J, et al. (2011): HM, RACE
|
S. natalensis |
| PimM |
- |
Positive |
-46:-23 |
GTACCTCTGGCATTTCCCCCAGTC |
Anton N, et al. (2007): DB, OV, RT-PCR
Santos-Aberturas J, et al. (2011): DP, GS, FT, HM, RACE
|
S. natalensis |
| PimR |
- |
Positive |
ND |
ND |
Anton N, et al. (2004): DB, RT-PCR
|
S. natalensis |
| Comments:
|
| Unknown_sigma |
To determine the transcriptional start sites of target promoters and to corroborate the monocistronic nature of some genes, such as pimJ and pimI, 5-RACE experiments were carried out. Once the -1 sites were known, the corresponding -10 and -35 boxes of each promoter were established by comparison with the matrices reported by Bourn and Babb (28) for Streptomyces that take into account the nucleotides occurring in 13-nucleotide
stretches, including the -10 or -35 consensus hexamers. |
| PimM |
GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic
mobility shift assays. The binding regions of PimM-DBD were investigated by DNase I protection studies. In
all cases, binding took place covering the -35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. |
| PimR |
Gene expression analysis by reverse transcriptase PCR (RT-PCR) of the pimaricin gene cluster revealed that S. natalensis DeltaPimR shows no expression at all of the cholesterol oxidase-encoding gene pimE, and very low level transcription of the remaining genes of the cluster except for the mutant pimR gene, thus demonstrating that this
regulator activates the transcription of all the genes belonging to the pimaricin gene cluster but not its own
transcription. |
Terminator
No Data
|
|