Transcription factor: AfsR
| Gene ID |
SCO4426 (link to ScoCyc) |
| Factor type |
ND |
| Pfam |
PF07721 (Tetratricopeptide repeat
)
PF00486 (Transcriptional regulatory protein, C terminal
)
|
| Consensus seq. |
GCGTTCA |
| Comment |
Two-component transcriptioanl activator. Additionally to afsK, pkaG and afsL phosphorylate AfsR (Sawai R, et al. 2004). Floreano B, et al. (1996) demonstrate that multiple copies of afsR can stimulate both actinorhodin (Act) and undecyl-prodigiosin (Red) production. |
| afsS |
None |
Positive |
4842709..4842768 |
-50:+10 |
GGTAGCCGGAGCGTTCAGCGTTCGTTTATCTCCCCCTGGCACTGTCATCTCCGTCAGACC |
Lee PC, et al. (2002): S1, GS, FT, DB
Umeyama T, et al. (2002): Review
Tanaka A, et al. (2007): S1, FT, SDM
|
| pstS |
None |
Negative |
4557974..4557994 |
-100:-80 |
GACGTAAGCGTTCCGTGACCT |
Santos-Beneit F,et al. (2009): GS,FT,DB
|
| pstS |
None |
Negative |
4557934..4557949 |
-55:-40 |
CCCGGCGTTCATTTAC |
Santos-Beneit F,et al. (2009): GS,FT,DB
|
| phoR |
None |
Negative |
4633190..4633224 |
-15:+20 |
CCTGGAGACATGGACGTGAACGCGGCGGTCGCCGC |
Santos-Beneit F,et al. (2009): GS,FT
|
| redD |
None |
Positive |
ND |
ND |
ND |
Floriano B, et al. (1996): OV (direct/indirect regulation is not clear), DB showed no effect.
|
| actII-ORF4 |
None |
Positive |
ND |
ND |
ND |
Floriano B, et al. (1996): OV (direct/indirect regulation is not clear), DB showed no effect.
|
|