Operon: No data
redD |
SCO5877 |
|
+ |
6432566..6433618 |
transcriptional regulator RedD |
Promoters
HrdD |
redD-p |
Promoter |
-50:+10 |
6432548..6432607 |
AATCCGATCGTTCGGTGGATGACGGGTGGGGGAGTGCTTGCCACGATGGACCCGGTTCGA |
Fujii T, et al. (1996): RO
Kang JG, et al. (1997): GS, RO
|
RedZ |
- |
Positive |
ND |
ND |
ND |
White J, et al. (1997): S1, DB
|
AfsR |
- |
Positive |
ND |
ND |
ND |
Floriano B, et al. (1996): OV (direct/indirect regulation is not clear), DB showed no effect.
|
HrdB |
redD-p |
Promoter |
-50:+10 |
6432548..6432607 |
AATCCGATCGTTCGGTGGATGACGGGTGGGGGAGTGCTTGCCACGATGGACCCGGTTCGA |
Fujii T, et al. (1996): DB, SDS-PAGE
Aigle B, et al. (2000): SDM
|
BldC |
- |
Positive |
ND |
ND |
ND |
Hunt AC, et al. (2005): DB,OV
|
WblA |
- |
Negative |
ND |
ND |
ND |
Kang SH, et al. (2007): AR, OV(RT-PCR)
|
RrdA |
- |
Negative |
ND |
ND |
ND |
Ou X, et al. (2009): DB,OV
|
SCO1712 |
- |
Negative |
ND |
ND |
ND |
Lee HN, et al. (2010): DB, OV(by RT-PCR)
Kang SH, et al. (2007): AR
|
SCO6008 |
- |
ND |
ND |
ND |
ND |
Park SS, et al. (2009): DACA(DNA-affinity capture assay; mass spectrometry), GS, DB
|
AdpA |
- |
Negative? |
ND |
ND |
ND |
Park SS, et al. (2009): DACA(DNA-affinity capture assay; mass spectrometry), GS, DB
|
SCO5405 |
- |
ND |
ND |
ND |
ND |
Park SS, et al. (2009): DACA(DNA-affinity capture assay; mass spectrometry), GS, DB
|
SCO1480 |
- |
ND |
ND |
ND |
ND |
Park SS, et al. (2009): DACA(DNA-affinity capture assay; mass spectrometry), GS, DB
|
Comments:
|
HrdD |
RedD must be regulated by at leaset one other sigma factor because disruption of hrdD had no effect on the production of redD. Fujii et al. surmise hrdB as a candidate. Kim YJ, et al. 2008(PMID: 19087294) also suggested sigH is also strongly upregulated by the pH shock. |
RedZ |
Transcription of redD strongly dependes on redZ. Although redZ does not depend on bldA (tRNA for rare leucine codon UUA) mutant, redD transcription was undetectable in bldA mutant (White J, et al. JB 1997, PMID: 9006013). |
SCO1712 |
Transcripts encoded by pathway-specific activator genes such as actII-ORF4, redD/Z, and cdaR were all significantly increased at both time points from S. coelicolor M145-SCO1712. As expected, an opposite transcription pattern was observed in the SCO1712-overexpressing S. coelicolor M145 strain. |
SCO6008 |
SCO6008 seemed to discriminate the two promoter regions, binding to only one of the two promoter regions, redD. our EMSA experiments showed the binding of SCO6008 onto the promoter of redD, not actII-ORF4, and that the direct and/or indirect regulation of SCO6008 on Act biosynthesis was quite possible. |
AdpA |
In S. coelicolor, the adpA-deletion mutant was found to be unable to produce Act, but to overproduce Red. AdpA, SCO5405, and SCO1480 showed binding activities to both the actII-ORF4 (PactII-ORF4) and redD (PredD) promoter regions. |
SCO5405 |
AdpA, SCO5405, and SCO1480 showed binding activities to both the actII-ORF4 (PactII-ORF4) and redD (PredD) promoter regions. |
SCO1480 |
AdpA, SCO5405, and SCO1480 showed binding activities to both the actII-ORF4 (PactII-ORF4) and redD (PredD) promoter regions. However, the binding of SCO1480 to PactII-ORF4 was not detected in DACA. |
Terminator
No Data
Overview
|
|