| Regulated gene:
| actII-ORF4
|
Operon: No data
| actII-ORF4 |
SCO5085 |
SCBAC28G1.11, actII-4, actII-ORF4 |
+ |
5528094..5528861 |
actinorhodin cluster activator protein |
Promoters
| HrdD |
actII-ORF4p |
Promoter |
-50:+10 |
5528013..5528072 |
TGACGGCAAGCACATTGAAATCTGTTGAGTAGGCCTGTTATTGTCGCCCCCAGGAGACGG |
Fujii T, et al. (1996): RO
Kang JG, et al. (1997): GS, RO
|
| AbsA2 |
- |
Negative |
ND |
ND |
ND |
McKenzie NL, et al. (2007): ChIP, DB, GS
Aceti DJ, et al. (1998): DB
|
| AmfC |
- |
Positive |
ND |
ND |
ND |
Yonekawa Y, et al. (1999): DB
|
| AfsR |
- |
Positive |
ND |
ND |
ND |
Floriano B, et al. (1996): OV (direct/indirect regulation is not clear), DB showed no effect.
|
| HrdB |
actII-ORF4p |
Promoter |
-50:+10 |
5528013..5528072 |
TGACGGCAAGCACATTGAAATCTGTTGAGTAGGCCTGTTATTGTCGCCCCCAGGAGACGG |
Fujii T, et al. (1996): DB, PAGE
Aigle B, et al. (2000): SDM
|
| AtrA |
- |
Positive |
ND |
5527887..5527915 |
CGTATCAGGAATGCCAGATTCTATTGATT |
Uguru GC, et al. (2005): GS, FT, DP, DB
|
| AtrA |
- |
Positive |
ND |
5528131..5528166 |
CCGATGCGGGATGTGTAATTCCGCTTAAATCCTCGA |
Uguru GC, et al. (2005): GS, FT, DP, DB
|
| BldC |
- |
Positive |
ND |
ND |
ND |
Hunt AC, et al. (2005): DB,OV
|
| NsdA |
- |
Negative |
ND |
ND |
ND |
Li W, et al. (2006): DB, HB
|
| WblA |
- |
Negative |
ND |
ND |
ND |
Kang SH, et al. (2007): AR, OV(RT-PCR)
|
| RapA1 |
- |
Positive |
ND |
ND |
ND |
Li Y, et al. (2007): DB (RT-PCR)
|
| RapA1 |
- |
Positive |
ND |
ND |
ND |
Li Y, et al. (2007): DB (RT-PCR)
|
| DasR |
- |
Negative |
-71:-31(from translation start site) |
5528023..5528062 |
CACATTGAAATCTGTTGAGTAGGCCTGTTATTGTCGCCCC |
Rigali S, et al. (2008): HM, GS, sqRT-PCR
|
| SCO1712 |
- |
Negative |
ND |
ND |
ND |
Lee HN, et al. (2010): DB, OV(by RT-PCR)
Kang SH, et al. (2007): AR
|
| AdpA |
- |
Positive? |
ND |
ND |
ND |
Park SS, et al. (2009): DACA(DNA-affinity capture assay; mass spectrometry), GS, DB
|
| SCO5405 |
- |
ND |
ND |
ND |
ND |
Park SS, et al. (2009): DACA(DNA-affinity capture assay; mass spectrometry), GS, DB
|
| SCO1480 |
- |
ND |
ND |
ND |
ND |
Park SS, et al. (2009): DACA(DNA-affinity capture assay; mass spectrometry), GS, DB
|
| Comments:
|
| HrdD |
ActII-ORF4 must be regulated by at leaset one other sigma factor because disruption of hrdD had no effect on the production of actII-ORF4. Fujii et al. surmise hrdB as a candidate. |
| DasR |
The dre site upstream from redZ is situated about 50 bp upstream from the -35 sequence of the redZ promoter. DasR bound to the dre elements for the actII-ORF4, redZ and crr-ptsI promoter regions, but not to the cis-acting element of Crp. Semiquantitative reverse transcription-PCR (RT-PCR) analyses further showed upregulation of actII-ORF4 and redZ in the dasR mutant. |
| SCO1712 |
Transcripts encoded by pathway-specific activator genes such as actII-ORF4, redD/Z, and cdaR were all significantly increased at both time points from S. coelicolor M145-SCO1712. As expected, an opposite transcription pattern was observed in the SCO1712-overexpressing S. coelicolor M145 strain. |
| AdpA |
In S. coelicolor, the adpA-deletion mutant was found to be unable to produce Act, but to overproduce Red. AdpA, SCO5405, and SCO1480 showed binding activities to both the actII-ORF4 (PactII-ORF4) and redD (PredD) promoter regions. |
| SCO5405 |
AdpA, SCO5405, and SCO1480 showed binding activities to both the actII-ORF4 (PactII-ORF4) and redD (PredD) promoter regions. |
| SCO1480 |
AdpA, SCO5405, and SCO1480 showed binding activities to both the actII-ORF4 (PactII-ORF4) and redD (PredD) promoter regions. However, the binding of SCO1480 to PactII-ORF4 was not detected in DACA. |
Terminator
No Data
Overview

|
|