DBSCR - Transcription factor

   Database of transcriptional regulation in Streptomyces coelicolor

Home
Transcription factors
Regulated genes
Revised TLS
Search
Contacts

Transcription factor: AdpA

Gene ID SCO2792 (link to ScoCyc)
Factor type ND
Pfam PF00165 (Bacterial regulatory helix-turn-helix proteins, AraC family )
Consensus seq. TGGSCNGWWYNN (from S.griseus)
Comment AdpA is an essential gene for streptomycin producing and aerial mycelium formation in S. griseus.
Orthologous link S. griseus Streptomyces others

Regulated Gene Sigma Regulation Absolute position Location Binding seq.(cis-element) Experimental evidence
melC1 None Positive ND ND ND Zhu D, et al. (2005): DB
sti None Positive 806808..806849 -179:-138 GAAGGTGCGGATCACGCCATTCGGCCAGTTCTGTTCTCAATA Kim DW, et al. (2005): DB, HM
sti None Positive 806733..806774 -104:-63 ACGTTCTAATTCTGTGACTTCACGCCACTGATTCAATACGCA Kim DW, et al. (2005): DB, HM
actII-ORF4 None Positive? ND ND ND Park SS, et al. (2009): DACA(DNA-affinity capture assay; mass spectrometry), GS, DB
redD None Negative? ND ND ND Park SS, et al. (2009): DACA(DNA-affinity capture assay; mass spectrometry), GS, DB




DBSCR:

Copyright: BASE, RIKEN
Contact: Yuko Makita